Detail of EST/Unigene TCSL73703 |
Acc. | TCSL73703 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Endoplasmin homolog OS=Catharanthus roseus E-value=0; Endoplasmin homolog OS=Arabidopsis thaliana E-value=0; Endoplasmin homolog OS=Hordeum vulgare E-value=0; Heat shock protein 90-1 OS=Arabidopsis thaliana E-value=0; Heat shock protein 81-1 OS=Oryza sativa subsp. japonica E-value=0; |
Length | 2824 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015436 (18 ESTs); SL_MicroLEAF3 (12 ESTs); SRR015435 (12 ESTs); LIBEST_024426 (7 ESTs); SL_maturing_fruit (5 ESTs); SL_SUS_LEAF (5 ESTs); SL_SHOOT_4WEEK (4 ESTs); SL_CELL_BTI (3 ESTs); SL_CROWNGALL (3 ESTs); SL_RES (3 ESTs); SL_TAMU (3 ESTs); SL_Lyc_leaf (3 ESTs); SL_germ_seedlings_TAMU (2 ESTs); SL_flowerbuds4 (2 ESTs); SL_cTOS (2 ESTs); SL_ROOT (2 ESTs); SL_TAMU_CALLUS (2 ESTs); SL_FRUIT (2 ESTs); SL_GFRUIT (2 ESTs); SL_pericarp (1 ESTs); SL_CALLUS (1 ESTs); SL_flower_anthesis (1 ESTs); SL_flower_buds8 (1 ESTs); SL_SEED (1 ESTs); SL_breaker_fruit (1 ESTs); SL_flower_buds3 (1 ESTs); SL_SHOOT_8WEEK (1 ESTs); SL_FLOWERBUDS (1 ESTs); SL_ROOT_pre-anthesis2 (1 ESTs); SL_MicroFRUIT2 (1 ESTs); LIBEST_025267 (1 ESTs); SL_FLOWERBUDS3 (1 ESTs); SL_FLOWER_DEV (1 ESTs); LIBEST_024457 (1 ESTs); SL_PRERIP_FRUIT_TAMU (1 ESTs); LIBEST_024456 (1 ESTs); |
Sequence | CAGATCAACACTCTACTTTGAACGCTGCTTGTAAAATCATCGGCCGGCGACCTCTAAAGT |
EST members of Unigene | BM409640 SRR015436.217062 BI921754 AI781164 AI781165 SRR015435.330647 BW689006 AW647647 SRR015435.183212 AW930608 BI422759 FS182686 BG628393 AW623861 BP891928 SRR015435.97282 BP889220 BG131738 AW737629 SRR015435.176732 SRR015436.28958 SRR015436.259818 SRR015435.132115 FS190145 AI485819 SRR015435.191358 SRR015436.171892 FS182741 SRR015435.130572 DB681277 AI774155 AI485616 DB697494 SRR015435.52487 SRR015435.135802 FS181287 SRR015435.60637 BG131771 DB701321 AW096765 SRR015435.350531 BP898978 SRR015436.175062 AI776074 SRR015436.318512 SRR015436.230448 DB680739 AI484353 BI206211 SRR015436.296672 AI772110 BP891851 FS181148 AI782638 BP906502 BE460881 BG643439 SRR015435.288754 GO374461 GO372816 BG124966 BG125352 FS202912 DB706060 BE451170 SRR015436.161754 SRR015436.248889 AI483204 SRR015436.34476 BE432539 AW094279 BI423376 DB693784 DB681551 BG124330 SRR015436.119696 AW031479 BF050739 AI897935 DB684762 FS206292 AW929809 SRR015436.262692 AW219562 BI933261 BE459833 DB704901 BP907560 DB706857 BG131916 SRR015436.303900 SRR015436.97742 CD003404 SRR015436.14597 BP883547 BI211049 AW651479 AW093739 AW621491 AI484369 BI423419 BP889153 GT168537 DB693149 AW036468 DB706358 SRR015436.203170 BI924420 SRR015436.304334 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828520 |
Trichome-related Gene from Literature | 828520 |