| Detail of EST/Unigene TCSL73746 |
| Acc. | TCSL73746 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Sulfite reductase 1 [ferredoxin], chloroplastic OS=Nicotiana tabacum E-value=0; Sulfite reductase [ferredoxin], chloroplastic OS=Pisum sativum E-value=0; Sulfite reductase [ferredoxin], chloroplastic OS=Arabidopsis thaliana E-value=0; Sulfite reductase [ferredoxin], chloroplastic (Fragment) OS=Glycine max E-value=0; Sulfite reductase [ferredoxin], chloroplastic OS=Zea mays E-value=0; |
| Length | 2437 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_Lyc_leaf (10 ESTs); SL_MicroLEAF3 (9 ESTs); SRR015435 (8 ESTs); SL_MicroFRUIT (4 ESTs); SL_FRUIT (4 ESTs); SL_FLOWERBUDS (4 ESTs); SL_GFRUIT (3 ESTs); SL_SUS_LEAF (3 ESTs); SL_germ_seedlings_TAMU (2 ESTs); SL_TAMU_CALLUS (2 ESTs); SL_PRERIP_FRUIT_TAMU (2 ESTs); SL_maturing_fruit (2 ESTs); SRR015436 (2 ESTs); LIBEST_024426 (2 ESTs); SL_RES (1 ESTs); SL_flowerbuds4 (1 ESTs); SL_FLOWER_DEV (1 ESTs); SL_ROOT_pre-anthesis2 (1 ESTs); SL_FLOWERBUDS3 (1 ESTs); SL_FLOWER (1 ESTs); SL_CROWNGALL (1 ESTs); SL_flower_buds3 (1 ESTs); SL_flower_buds4 (1 ESTs); |
| Sequence | CACCACCCAAATATTTTTGCTCAAATATCTGTATACTCTCTCCGCCATTTTCACAAAATT |
| EST members of Unigene | BG133661 BI930472 AW650081 BP911346 BP900716 DB698163 AI777765 FS200548 SRR015435.136676 BI929969 BE353785 BP877376 SRR015435.225278 BI924995 SRR015436.121190 BP910955 DB709017 BP896073 BP910714 SRR015435.105176 AW930371 BP907243 FS179239 DB688289 SRR015435.339881 AI772075 BE458560 DB694266 AW928549 SRR015436.12165 SRR015435.94675 BE450624 AW930357 AW429283 AI895714 BE354427 AI777836 DB684404 DB709447 BF051542 DB682376 DB694053 AW738794 BG735498 BE437043 AW648448 BE437049 DB708029 BE460028 BP910070 DB722717 DB692508 SRR015435.260370 SRR015435.311517 SRR015435.146524 BE432894 BE432895 AI781504 BP896134 DB703603 BP900991 BE354422 DB719537 BP880883 BP905799 AW034074 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 830336 |
| Trichome-related Gene from Literature | 830336 |