Detail of EST/Unigene TCSL78018 |
Acc. | TCSL78018 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 40S ribosomal protein S13 OS=Glycine max E-value=2e-76; 40S ribosomal protein S13-2 OS=Arabidopsis thaliana E-value=6e-74; 40S ribosomal protein S13-1 OS=Arabidopsis thaliana E-value=1e-73; 40S ribosomal protein S13 OS=Pisum sativum E-value=5e-73; 40S ribosomal protein S13-2 OS=Oryza sativa subsp. japonica E-value=1e-68; |
Length | 880 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015436 (17 ESTs); SL_TAMU (10 ESTs); SRR015435 (9 ESTs); SL_SHOOT_4WEEK (6 ESTs); SL_maturing_fruit (5 ESTs); SL_CROWNGALL (4 ESTs); SL_MicroFRUIT2 (4 ESTs); SL_RES (4 ESTs); LIBEST_024426 (4 ESTs); SL_SHOOT_8WEEK (3 ESTs); SL_cTOS (3 ESTs); SL_SUS_LEAF (3 ESTs); SL_FLOWER_DEV (3 ESTs); SL_PRERIP_FRUIT_TAMU (2 ESTs); SL_CELL_BTI (2 ESTs); SL_FLOWERBUDS3 (2 ESTs); LIBEST_024458 (1 ESTs); LIBEST_024456 (1 ESTs); SL_radicle (1 ESTs); SL_Lyc_leaf (1 ESTs); SL_GFRUIT (1 ESTs); SL_DROOT (1 ESTs); SL_germ_seedlings_TAMU (1 ESTs); SL_breaker_fruit (1 ESTs); SL_flower_buds8 (1 ESTs); SL_flowerbuds4 (1 ESTs); SL_MicroLEAF3 (1 ESTs); SL_ROOT (1 ESTs); SL_ROOT_pre-anthesis2 (1 ESTs); SL_ROOT_pre-anthesis (1 ESTs); SL_CDS (1 ESTs); SL_TAMU_CALLUS (1 ESTs); SL_DEF_ROOT (1 ESTs); SL_RIP_FRUIT_TAMU (1 ESTs); |
Sequence | CGGCCGGGGCTTCCGCACAACCAAAGGTAAGCCTCCATTGCAGACCACCAGTAGCCTCCG |
EST members of Unigene | SRR015436.313831 SRR015435.242010 AI779487 SRR015435.49324 FS187356 AI489950 SRR015436.82827 BP892580 AI489170 SRR015436.228942 BG129258 BP904958 GO376022 FS201731 SRR015435.128954 BE460137 AW223518 AW932839 BG643450 BI205810 SRR015436.322398 BG128681 BP889889 BP894894 SRR015436.294818 BI423032 BI204612 AI489540 SRR015436.96549 AW621413 BG132939 FS187336 AI772431 AI486800 BG643013 BG629790 BG123819 SRR015435.311026 BG133733 BW689856 AW928730 SRR015436.42011 BP894307 SRR015436.271871 AW650629 BW690045 SRR015436.29816 AW091615 SRR015436.74128 SRR015436.104024 SRR015436.165678 AI483150 DB706408 AI483146 AI782126 BE450139 SRR015436.265060 SRR015435.174999 BG130760 SRR015435.158310 AI898144 BF114241 SRR015436.87507 SRR015436.96572 AI776690 BG126881 AI484050 SRR015436.243196 BP895813 AI772211 SRR015436.25894 AW625167 GO373442 BG629345 EG553346 AW929802 AI775602 AW934625 AI485322 AI488630 AI483945 AI778351 BG625996 BF098413 BW690093 BM536252 BI206224 SRR015435.296418 AW220865 FS189050 AI486920 SRR015435.333599 AW623234 BG134774 SRR015435.288654 BW691523 AI482684 AW040453 BT014336 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02953 small subunit ribosomal protein S13e |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828167 |
Trichome-related Gene from Literature | 828167 |