| Detail of EST/Unigene TCSL79665 |
| Acc. | TCSL79665 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Rac-like GTP-binding protein RHO1 OS=Beta vulgaris E-value=7e-94; Rac-like GTP-binding protein ARAC1 OS=Arabidopsis thaliana E-value=7e-94; Rac-like GTP-binding protein ARAC11 OS=Arabidopsis thaliana E-value=5e-93; Rac-like GTP-binding protein ARAC6 OS=Arabidopsis thaliana E-value=6e-93; Rac-like GTP-binding protein RHO1 OS=Pisum sativum E-value=2e-92; |
| Length | 767 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | LIBEST_024426 (7 ESTs); SRR015435 (4 ESTs); SL_MicroLEAF3 (1 ESTs); SL_FRUIT (1 ESTs); SRR015436 (1 ESTs); LIBEST_025267 (1 ESTs); SL_PRERIP_FRUIT_TAMU (1 ESTs); SL_radicle (1 ESTs); SL_maturing_fruit (1 ESTs); SL_flower_buds3 (1 ESTs); |
| Sequence | GTCTCAGCTCTTCTTCTTCGTTGGTTGACAGACACACAGAGAGAGAGAAAAAACAGTGTT |
| EST members of Unigene | FS190235 DB689848 FS205833 BI926300 FS192565 AW218480 SRR015435.160568 BP881350 SRR015436.261444 AW930158 BE460935 SRR015435.325795 FS179245 GT167308 SRR015435.164512 FS190074 SRR015435.273115 FS190303 FS201001 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1 |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 9.A.5 Peroxisomal protein importer PPI |
| Probeset |
|
| Corresponding NCBI Gene | 816290 |
| Trichome-related Gene from Literature | 816290 |