| Detail of EST/Unigene TCCS20019 |
| Acc. | TCCS20019 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3, chloroplastic OS=Glycine max E-value=0; Chlorophyll a-b binding protein of LHCII type I, chloroplastic (Fragment) OS=Cucumis sativus E-value=0; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=0; |
| Length | 911 nt |
| Species | Cannabis sativa |
| Belonged EST Libraries | |
| Sequence | GCTCACATATCCAACCCCCAAAAAAATACATTTGGTAAAAAAACAAAAAAAAAACCATGT |
| EST members of Unigene | EG974252 EG974253 JK499072 EG974254 EG974255 EG974256 EG974257 EG974258 EG974259 EG974260 EW700640 EG974250 JK498813 JK493549 JK493161 JK493162 EW701228 EW701232 EW701159 EG974261 JK499389 EW701034 JK498351 EW700471 EW700475 JK498599 EW701068 EW701071 GR221159 EW700715 EW701253 EG974265 EG974266 EW701270 JK498728 EW701284 JK493239 JK494172 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |