| Detail of EST/Unigene TCHL61528 |
| Acc. | TCHL61528 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Type II inositol 1,4,5-trisphosphate 5-phosphatase FRA3 OS=Arabidopsis thaliana E-value=3e-34; Type I inositol 1,4,5-trisphosphate 5-phosphatase 12 OS=Arabidopsis thaliana E-value=1e-28; Type I inositol 1,4,5-trisphosphate 5-phosphatase 13 OS=Arabidopsis thaliana E-value=6e-28; Type II inositol 1,4,5-trisphosphate 5-phosphatase 14 OS=Arabidopsis thaliana E-value=5e-21; |
| Length | 732 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546170 (6 ESTs); SRR546172 (5 ESTs); SRR546165 (4 ESTs); HLUTR3CH (3 ESTs); SRR546168 (2 ESTs); |
| Sequence | TCGTTAATGAGGATGGGCTTGCATCAGATCATTGTCCTAGAGGCTCCTTTTGGCTTTCCC |
| EST members of Unigene | SRR546170.164579 SRR546170.113183 SRR546172.88926 SRR546168.97562 SRR546165.7907 SRR546170.145697 SRR546172.34302 SRR546165.273485 SRR546170.99354 SRR546165.66798 SRR546172.49843 SRR546172.157988 GD251817 SRR546172.82259 GD253514 SRR546168.83565 GD253583 SRR546165.221367 SRR546170.162598 SRR546170.56143 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842869 |
| Trichome-related Gene from Literature | 842869 |