Detail of EST/Unigene TCMT42577 |
Acc. | TCMT42577 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Allene oxide synthase, chloroplastic OS=Linum usitatissimum E-value=2e-89; Allene oxide synthase, chloroplastic OS=Arabidopsis thaliana E-value=3e-85; Allene oxide synthase OS=Parthenium argentatum E-value=3e-79; Allene oxide synthase 2 OS=Oryza sativa subsp. japonica E-value=4e-76; 9-divinyl ether synthase OS=Nicotiana tabacum E-value=4e-73; |
Length | 1607 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT (13 ESTs); MT_Shoots (3 ESTs); MT_DSTEM2 (3 ESTs); MT_JCVI-MT2 (2 ESTs); MT_CDS (1 ESTs); MT_GSEED (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_DSIL (1 ESTs); |
Sequence | GAAAACATAACCATAAAGTGTGACCTCCACCGAACTCTCTTCTCTTCTTCTCTACCATGT |
EST members of Unigene | DQ011231 CX537183 CX527799 CX524846 CX524648 AW697309 AW692844 AW689016 EV254959 BF518676 BI268242 BI268233 BI267960 BI266354 BI266179 BI265216 BG449285 BE321376 BE321892 BF642456 BF642402 BF639797 BF639545 GE349908 GE344883 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07424 cytochrome P450, family 3, subfamily A; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K07424 cytochrome P450, family 3, subfamily A; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00361 gamma-Hexachlorocyclohexane degradation > K07424 cytochrome P450, family 3, subfamily A; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07424 cytochrome P450, family 3, subfamily A; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07424 cytochrome P450, family 3, subfamily A; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07424 cytochrome P450, family 3, subfamily A |
EC | 1.14.-.- 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.3143.1.S1_at, Mtr.21518.1.S1_at, Mtr.21518.1.S1_s_at, Mtr.9885.1.S1_at
|
Corresponding NCBI Gene | 827215 |
Trichome-related Gene from Literature | N/A |