Detail of EST/Unigene TCMT42756 |
Acc. | TCMT42756 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | BTB/POZ and TAZ domain-containing protein 4 OS=Arabidopsis thaliana E-value=0; BTB/POZ and TAZ domain-containing protein 5 OS=Arabidopsis thaliana E-value=0; BTB/POZ and TAZ domain-containing protein 3 OS=Arabidopsis thaliana E-value=2e-96; BTB/POZ and TAZ domain-containing protein 2 OS=Arabidopsis thaliana E-value=7e-66; BTB/POZ and TAZ domain-containing protein 1 OS=Arabidopsis thaliana E-value=1e-64; |
Length | 1730 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED (3 ESTs); MT_JCVI-MT1 (2 ESTs); MT_JCVI-MT2 (2 ESTs); MT_BML (1 ESTs); MT_CDS (1 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_NOD_ROOT (1 ESTs); MT_SROOT_KV0 (1 ESTs); MT_Drought (1 ESTs); MT_INSECT (1 ESTs); |
Sequence | GGGAAACAGAAAGAGAAGAAGTAATTCACAAACCCCCCTGGGATTCCTCTCTTCTTTTCT |
EST members of Unigene | BT052278 CA920895 CX538454 CX537463 CX536146 EV261641 EV255102 DW015445 AW685198 BE187605 BF632107 BG449376 GE350727 GE345822 GD185853 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04630 Jak-STAT signaling pathway > K04498 E1A/CREB-binding protein; Environmental Information Processing > Signal Transduction > ko04330 Notch signaling pathway > K04498 E1A/CREB-binding protein; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K04498 E1A/CREB-binding protein; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04498 E1A/CREB-binding protein |
EC | 2.3.1.48 |
Transcription Factor Family | CO-like |
Transporter Classification Family | |
Probeset |
Mtr.21276.1.S1_at
|
Corresponding NCBI Gene | 836884 |
Trichome-related Gene from Literature | N/A |