| Detail of EST/Unigene TCMT43202 |
| Acc. | TCMT43202 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Putative bark agglutinin LECRPA3 (Fragment) OS=Robinia pseudoacacia E-value=1e-60; Non-seed lectin OS=Pisum sativum E-value=5e-56; Galactose-binding lectin OS=Arachis hypogaea E-value=6e-49; Nodule lectin OS=Pisum sativum E-value=3e-48; Anti-H(O) lectin OS=Lotus tetragonolobus E-value=6e-46; |
| Length | 1116 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_NOD_GVN (29 ESTs); MtBB_NOD (8 ESTs); MT_NOD_GVSN (5 ESTs); MtSN4 (4 ESTs); MT_JCVI-MT3 (3 ESTs); MTUS_MIXTISSUE (2 ESTs); MT_KVKC (2 ESTs); MT_NOD_ROOT (1 ESTs); |
| Sequence | ACGCGGGATAACTCAGTAACACAACTGCATACTAGCTACCATGGCTTTGACCAACTCAAA |
| EST members of Unigene | CF069724 CA920121 AL380802 AL380801 AL380299 AL380298 AL379957 AL379956 AL376717 AL376716 BE999426 BE998580 BE998015 AW208274 AW208260 BG583800 BG583489 BG583442 BG583396 BG583362 BG583261 BG583058 BG583018 BG582972 BG582966 BG582896 BG582676 BG582057 BG581969 BG581791 BG581447 BG581274 BG580804 BG580797 BG580050 BE124642 BE124558 AW980835 AW980737 AW980558 AW980543 AW127289 AW775223 AW574306 AW685619 AJ848266 AJ848255 AJ848210 AJ848139 BQ255292 BQ165778 EY478580 EY476661 EY477373 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.43106.1.S1_at
|
| Corresponding NCBI Gene | 830918 |
| Trichome-related Gene from Literature | N/A |