Detail of EST/Unigene TCMT43421 |
Acc. | TCMT43421 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Polygalacturonase inhibitor OS=Pyrus communis E-value=1e-30; Polygalacturonase inhibitor 2 OS=Arabidopsis thaliana E-value=5e-30; Polygalacturonase inhibitor 1 OS=Arabidopsis thaliana E-value=2e-29; Polygalacturonase inhibitor OS=Vitis vinifera E-value=7e-27; Polygalacturonase inhibitor 1 OS=Oryza sativa subsp. japonica E-value=1e-22; |
Length | 849 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS (7 ESTs); MHRP-root (4 ESTs); MT_NOD_GVN (3 ESTs); MT_SROOT_KV1 (2 ESTs); MtBB_NOD (2 ESTs); MT_JAS_ROOR (2 ESTs); MT_Drought (1 ESTs); MT_DROOT (1 ESTs); MT_IROOT_DSIR (1 ESTs); MT_ECELL (1 ESTs); MT_DLEAF (1 ESTs); |
Sequence | GGCTCAAACCATCTCTTCTTATTTGTTCAAATATAAGATGAAGACTCCTCCAAACATGTT |
EST members of Unigene | AL389224 AL384392 AL384391 AL383027 AL383026 AL381598 AL381597 AL380152 AL380151 BE320794 AW560508 BF647955 BG582677 BG581910 BG580910 BG589080 BE240111 BE240110 BE240100 BG454204 CX530547 CX528869 BF003259 BE202634 BF632070 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 3.A.2 H+- or Na+-translocating F-type, V-type and A-type ATPase superfamily F-ATPase |
Probeset |
Mtr.47298.1.S1_at
|
Corresponding NCBI Gene | 830578 |
Trichome-related Gene from Literature | N/A |