| Detail of EST/Unigene TCMT43592 |
| Acc. | TCMT43592 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Abscisate beta-glucosyltransferase OS=Phaseolus angularis E-value=0; Anthocyanin 3'-O-beta-glucosyltransferase OS=Gentiana triflora E-value=0; UDP-glucose flavonoid 3-O-glucosyltransferase 7 OS=Fragaria ananassa E-value=0; UDP-glycosyltransferase 73B4 OS=Arabidopsis thaliana E-value=0; UDP-glycosyltransferase 73B5 OS=Arabidopsis thaliana E-value=0; |
| Length | 1727 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSIL (4 ESTs); MT_JAS_ROOR (3 ESTs); MT_HOGA (3 ESTs); MT_IROOT_DSIR (3 ESTs); MtBC_GLOMUS (2 ESTs); MT_NOD_ROOT (2 ESTs); MT_DSLC (1 ESTs); |
| Sequence | CTTCCTCATAACTCACAGTTTTTCACTAAGCAAGTCAAGTGAGTTGTGAGCATCATCATC |
| EST members of Unigene | AL382183 AL382182 AW560575 AW560468 AW267849 BF006118 AW686453 AW684875 BE124261 AW776713 AW776439 AW775707 CX534521 CX532219 CX529076 CB894286 CB893528 BG648764 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00699 glucuronosyltransferase; Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K00699 glucuronosyltransferase |
| EC | 2.4.1.17 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.16942.1.S1_at
|
| Corresponding NCBI Gene | 816041 |
| Trichome-related Gene from Literature | N/A |