Detail of EST/Unigene TCMT43713 |
Acc. | TCMT43713 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Uridine 5'-monophosphate synthase (Fragment) OS=Nicotiana tabacum E-value=0; Uridine 5'-monophosphate synthase OS=Arabidopsis thaliana E-value=0; Uridine 5'-monophosphate synthase OS=Homo sapiens E-value=5e-91; Uridine 5'-monophosphate synthase OS=Pongo abelii E-value=9e-91; Uridine 5'-monophosphate synthase OS=Mus musculus E-value=4e-90; |
Length | 1429 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBA (2 ESTs); MT_GSEED (2 ESTs); MTFLOW (1 ESTs); MT_TRI (1 ESTs); MT_SROOT_KV0 (1 ESTs); |
Sequence | AGATCAGTGATGCGGTTGTCCTGATTGATAGAGAGCAAGGTGGGCGGGAAAATTTGGAGG |
EST members of Unigene | CX538150 CX538111 BE203967 AJ497697 AL369479 AL369478 EX530801 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00762 orotate phosphoribosyltransferase; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K00762 orotate phosphoribosyltransferase; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K01591 orotidine-5'-phosphate decarboxylase |
EC | 2.4.2.10 4.1.1.23 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.12781.1.S1_at
|
Corresponding NCBI Gene | 824612 |
Trichome-related Gene from Literature | N/A |