Detail of EST/Unigene TCMT44000 |
Acc. | TCMT44000 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glyoxylate reductase OS=Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3) E-value=3e-32; Glyoxylate reductase OS=Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1) E-value=7e-30; Glyoxylate reductase OS=Thermococcus litoralis E-value=3e-29; Glyoxylate reductase OS=Pyrococcus kodakaraensis (strain ATCC BAA-918 / JCM 12380 / KOD1) E-value=5e-29; Glyoxylate reductase OS=Thermococcus onnurineus (strain NA1) E-value=8e-29; |
Length | 872 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTAMP (2 ESTs); MT_JAS_ROOR (2 ESTs); MT_CDS (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MtSNF (1 ESTs); MTPOSE (1 ESTs); MT_Drought (1 ESTs); |
Sequence | AAAAAAAACAATGTTATCTGAATCATCACATCACCATCCTCGTAGCTGAATCGAACCCTC |
EST members of Unigene | BT051900 EV257551 DW018896 AJ503855 AJ502690 AJ845599 AJ498636 CX534502 CX529817 BF636618 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00630 Glyoxylate and dicarboxylate metabolism > K00015 glyoxylate reductase; Metabolism > Carbohydrate Metabolism > ko00630 Glyoxylate and dicarboxylate metabolism > K00049 glyoxylate reductase (NADP+); Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00049 glyoxylate reductase (NADP+) |
EC | 1.1.1.26 1.1.1.79 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.41103.1.S1_at
|
Corresponding NCBI Gene | 844326 |
Trichome-related Gene from Literature | N/A |