| Detail of EST/Unigene TCMT44192 |
| Acc. | TCMT44192 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome b5 OS=Nicotiana tabacum E-value=6e-59; Cytochrome b5, seed isoform OS=Nicotiana tabacum E-value=1e-57; Probable cytochrome b5 isoform 2 OS=Arabidopsis thaliana E-value=2e-57; Cytochrome b5 OS=Borago officinalis E-value=1e-54; Cytochrome b5 OS=Oryza sativa subsp. japonica E-value=5e-54; |
| Length | 739 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2 (2 ESTs); MT_PhoLEAF (1 ESTs); MT_VILEAF (1 ESTs); MT_DROOT (1 ESTs); MT_IROOT_DSIR (1 ESTs); MT_GESD (1 ESTs); MT_DSIL (1 ESTs); |
| Sequence | CAACTACCCACCTCATTTTTTCCCTCTTTATTTCAGATACTCTCAATTTTTGTGACTACT |
| EST members of Unigene | AW687153 AW560516 BI311116 AW777017 BF639057 CX518488 GE347536 GE347420 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00530 Aminosugars metabolism > K00326 cytochrome-b5 reductase; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K10224 fatty acid desaturase 1 (delta-5 desaturase); Metabolism > Lipid Metabolism > ko00592 alpha-Linolenic acid metabolism > K10226 fatty acid desaturase 2 (delta-6 desaturase); Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K10226 fatty acid desaturase 2 (delta-6 desaturase) |
| EC | 1.14.19.- 1.6.2.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.2661.1.S1_at, Mtr.41232.1.S1_at, Mtr.5506.1.S1_at
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |