Detail of EST/Unigene TCMT46388 |
Acc. | TCMT46388 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Vicianin hydrolase (Fragment) OS=Vicia sativa subsp. nigra E-value=0; Beta-glucosidase 12 OS=Oryza sativa subsp. japonica E-value=0; Beta-glucosidase 13 OS=Oryza sativa subsp. japonica E-value=0; Beta-glucosidase 17 OS=Arabidopsis thaliana E-value=0; Beta-glucosidase 11 OS=Oryza sativa subsp. japonica E-value=0; |
Length | 1732 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2 (20 ESTs); MT_DFLOWER (6 ESTs); MT_DLEAF (6 ESTs); MT_INSECT (5 ESTs); MT_GESD (4 ESTs); MT_SIRRA (4 ESTs); MT_Shoots (4 ESTs); MT_GSEED (3 ESTs); MT_PhoLEAF (2 ESTs); MT_BML (1 ESTs); MT_TRI (1 ESTs); GLSD (1 ESTs); MTFLOW (1 ESTs); MT_Drought (1 ESTs); |
Sequence | TTCGGCACGAGGGCCATGGGAGCTATAGGTCCTTCCCTTCTCTATCTTTTTTCTCTAGCT |
EST members of Unigene | CX542297 CX538887 CX537395 CX527705 CX526618 CX524689 CX523923 BG447620 AW691092 AW693738 BE325248 BE326043 AW693252 AW694699 AW690900 AW695132 AW694636 BE325564 BE325380 BE325826 AW694570 AW693274 AW692562 AW692099 AW690703 AW689643 AW689327 BI310960 BI310920 BI310646 BI310213 BQ149616 BQ149062 BQ148734 BQ148159 BI273302 BI271395 BE316957 BE315643 BE317164 BE249440 AW683123 BE318373 BQ122704 BG457972 BG456555 BQ155508 BQ155197 BI269766 BI269211 AJ497352 BG450170 BI267927 BI267866 BG449299 BF641513 BF639915 GD185796 EX526686 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K01229 lactase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
EC | 3.2.1.108 3.2.1.21 3.2.1.62 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.43075.1.S1_at
|
Corresponding NCBI Gene | 819055 |
Trichome-related Gene from Literature | N/A |