Detail of EST/Unigene TCMT46638 |
Acc. | TCMT46638 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Rac-like GTP-binding protein RHO1 OS=Pisum sativum E-value=9e-97; Rac-like GTP-binding protein RHO1 OS=Beta vulgaris E-value=5e-95; Rac-like GTP-binding protein ARAC1 OS=Arabidopsis thaliana E-value=6e-95; Rac-like GTP-binding protein ARAC6 OS=Arabidopsis thaliana E-value=8e-95; Rac-like GTP-binding protein ARAC11 OS=Arabidopsis thaliana E-value=8e-95; |
Length | 867 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF (2 ESTs); MT_JCVI-MT3 (1 ESTs); MT_JCVI-MT2 (1 ESTs); MT_CDS (1 ESTs); MT_JCVI-MT1 (1 ESTs); GLSD (1 ESTs); MtBA (1 ESTs); |
Sequence | GGAACGAAACGAACGGTTCAACGCTAAAATCACACTCTCATCTTCCAAATAGATGTGTGA |
EST members of Unigene | BT051480 EV258552 CA858251 BE323736 BE324231 AL368388 EY474764 GE345798 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 9.A.5 Peroxisomal protein importer PPI |
Probeset |
Mtr.43489.1.S1_at
|
Corresponding NCBI Gene | 816290 |
Trichome-related Gene from Literature | 816290 |