Detail of EST/Unigene TCMT49450 |
Acc. | TCMT49450 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Inositol-3-phosphate synthase OS=Nicotiana tabacum E-value=0; Inositol-3-phosphate synthase OS=Nicotiana paniculata E-value=0; Inositol-3-phosphate synthase OS=Sesamum indicum E-value=0; Inositol-3-phosphate synthase OS=Mesembryanthemum crystallinum E-value=0; Probable inositol 3-phosphate synthase isozyme 3 OS=Arabidopsis thaliana E-value=0; |
Length | 1832 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF (29 ESTs); MT_INSECT (21 ESTs); MT_Drought (17 ESTs); MT_Shoots (7 ESTs); MT_DLEAF (7 ESTs); MT_DSLC (5 ESTs); MT_PhoLEAF (4 ESTs); MT_DSTEM2 (4 ESTs); MT_GPOD (2 ESTs); MT_BML (1 ESTs); MT_TRI (1 ESTs); MT_UV-B (1 ESTs); MT_DFLOWER (1 ESTs); |
Sequence | CAACAAGTAACCACCCTTCTTGAGAAAAATAACTCTCTTCCTTTTTTTCTCTCGTGATTT |
EST members of Unigene | CX527549 CX526892 CX526825 CX526004 CX524811 CX524545 CX524054 AW693637 AW693470 AW696531 AW690715 BF006179 BF005852 BF005703 BF005517 BF005050 DY633346 BQ147478 BG454774 BG454475 BG454270 BG453168 BG452150 AW683693 BF636679 CB066741 CA917679 BI264430 BG457582 BF637689 BE322995 CX523107 CX522491 CX522316 CX521901 CX521826 CX521644 CX521367 CX521155 CX520891 CX520660 CX520556 CX520288 CX519952 CX519796 CX519639 CX519262 CX519167 CX518500 CX518413 CX518399 CX518283 CX517931 CX517668 CX517435 CX517434 CX517375 CX517355 CX516717 CX516617 BG451437 BG451154 BG451010 BG450187 BE248729 BE248740 BE248631 BE247997 BE248334 BE248552 BF636569 BF636522 BF635174 BF634448 BF633623 BF631868 BE249158 BI268088 BI267754 BI267395 BI267160 BI266945 BI266435 BI266433 BI266309 BI266230 BI265414 BI265276 BI265038 BG448900 BE321363 BE322490 BF642785 BF641774 BF641257 BF640552 BF639302 BE322142 GD185262 EX526410 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00521 Streptomycin biosynthesis > K01858 myo-inositol-1-phosphate synthase; Metabolism > Carbohydrate Metabolism > ko00562 Inositol phosphate metabolism > K01858 myo-inositol-1-phosphate synthase |
EC | 5.5.1.4 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.35794.1.S1_s_at, Mtr.42849.1.S1_at
|
Corresponding NCBI Gene | 830881 |
Trichome-related Gene from Literature | N/A |