Detail of EST/Unigene TCMT49970 |
Acc. | TCMT49970 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable mannitol dehydrogenase OS=Medicago sativa E-value=0; Probable mannitol dehydrogenase 1 OS=Stylosanthes humilis E-value=0; Probable cinnamyl alcohol dehydrogenase 9 OS=Arabidopsis thaliana E-value=0; Cinnamyl alcohol dehydrogenase 3 OS=Arabidopsis thaliana E-value=0; Cinnamyl alcohol dehydrogenase 2 OS=Arabidopsis thaliana E-value=0; |
Length | 1362 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2 (6 ESTs); MT_PhoLEAF (3 ESTs); MT_FLOSEED_MTY (2 ESTs); MTAMP (1 ESTs); MT_DLEAF (1 ESTs); MT_GPOD (1 ESTs); MT_VILEAF (1 ESTs); |
Sequence | GGATATAAGTCAATAAATACACCAACACTACGCTAGTACACTTCACTTCATTCACACAAA |
EST members of Unigene | DW017784 DW015339 AJ502021 BG454002 CA917295 BG457614 BG455666 BG455611 CX517067 GE350879 GE350828 GE349645 GE344588 GE345993 GE345937 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00624 1- and 2-Methylnaphthalene degradation > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00641 3-Chloroacrylic acid degradation > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00001 alcohol dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00001 alcohol dehydrogenase; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K00001 alcohol dehydrogenase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K00001 alcohol dehydrogenase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00001 alcohol dehydrogenase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 |
EC | 1.1.1.1 1.1.1.284 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.24075.1.S1_at
|
Corresponding NCBI Gene | 830088 |
Trichome-related Gene from Literature | N/A |