Detail of EST/Unigene TCMT50201 |
Acc. | TCMT50201 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Aspartate aminotransferase, mitochondrial OS=Arabidopsis thaliana E-value=0; Aspartate aminotransferase, mitochondrial OS=Dictyostelium discoideum E-value=0; Aspartate aminotransferase, mitochondrial OS=Rattus norvegicus E-value=0; Aspartate aminotransferase, mitochondrial OS=Mus musculus E-value=0; Aspartate aminotransferase, mitochondrial OS=Macaca fascicularis E-value=0; |
Length | 1564 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL (1 ESTs); MT_JAS_ROOR (1 ESTs); MT_HOGA (1 ESTs); MT_INSECT (1 ESTs); MT_JCVI-MT3 (1 ESTs); MT_JCVI-MT2 (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_NOD_ROOT (1 ESTs); MT_GESD (1 ESTs); MT_SEEDROOT_KV3 (1 ESTs); |
Sequence | GGATAGATTTGGATCCTAGTGAACACATTCTGCTGCTTCTTCTTTCATTTCCTCTGTTCT |
EST members of Unigene | DW016888 AW685712 CA990703 AW736111 BF520737 CX528858 CB894014 BE321736 EY474452 GE348552 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00950 Alkaloid biosynthesis I > K00813 aspartate aminotransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00401 Novobiocin biosynthesis > K00813 aspartate aminotransferase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00813 aspartate aminotransferase; Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K00813 aspartate aminotransferase; Metabolism > Amino Acid Metabolism > ko00330 Arginine and proline metabolism > K00813 aspartate aminotransferase; Metabolism > Amino Acid Metabolism > ko00272 Cysteine metabolism > K00813 aspartate aminotransferase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K00813 aspartate aminotransferase; Metabolism > Amino Acid Metabolism > ko00360 Phenylalanine metabolism > K00813 aspartate aminotransferase; Metabolism > Amino Acid Metabolism > ko00400 Phenylalanine, tyrosine and tryptophan b |
EC | 2.6.1.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.52344.1.S1_at
|
Corresponding NCBI Gene | 817648 |
Trichome-related Gene from Literature | N/A |