| Detail of EST/Unigene TCMT50395 |
| Acc. | TCMT50395 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase U10 OS=Arabidopsis thaliana E-value=2e-46; Glutathione S-transferase U9 OS=Arabidopsis thaliana E-value=5e-45; Glutathione S-transferase U8 OS=Arabidopsis thaliana E-value=4e-42; Probable glutathione S-transferase OS=Glycine max E-value=3e-39; Glutathione S-transferase U4 OS=Arabidopsis thaliana E-value=3e-39; |
| Length | 965 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_ROOTPHOS (3 ESTs); MT_SROOT_KV0 (1 ESTs); MT_MGHG (1 ESTs); MT_JCVI-MT3 (1 ESTs); MT_IROOT_DSIR (1 ESTs); MTAMP (1 ESTs); |
| Sequence | TCATATTCATATCCAATGGGTGAAGAAACAAGTGAAGTTGTGTTGTTGGGAAACTGGGCT |
| EST members of Unigene | AW559685 AW126114 AW126026 AW126020 AJ502659 BE203540 BE942779 EY474144 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
| EC | 2.5.1.18 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.35335.1.S1_s_at, Mtr.43621.1.S1_at
|
| Corresponding NCBI Gene | 843799 |
| Trichome-related Gene from Literature | N/A |