| Detail of EST/Unigene TCMT50680 |
| Acc. | TCMT50680 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | GMP synthase [glutamine-hydrolyzing] OS=Macrococcus caseolyticus (strain JCSC5402) E-value=2e-38; GMP synthase [glutamine-hydrolyzing] OS=Brachyspira hyodysenteriae (strain ATCC 49526 / WA1) E-value=3e-38; GMP synthase [glutamine-hydrolyzing] OS=Vibrio vulnificus (strain YJ016) E-value=6e-38; GMP synthase [glutamine-hydrolyzing] OS=Vibrio vulnificus (strain CMCP6) E-value=8e-38; GMP synthase [glutamine-hydrolyzing] OS=Bartonella bacilliformis (strain ATCC 35685 / KC583) E-value=2e-37; |
| Length | 952 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSTEM2 (2 ESTs); MT_NOD_NOLLY (1 ESTs); MT_ECELL (1 ESTs); MT_LEAF_PHOMA (1 ESTs); MT_JCVI-MT2 (1 ESTs); |
| Sequence | GGGCATTTGCATAAACCCTACTGAGTGGAGTTGGTTCTACTAGCAAGAGAGTACAGCAGC |
| EST members of Unigene | DY617101 AW697172 AW687936 BF650952 BQ140518 GE347693 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K01951 GMP synthase (glutamine-hydrolysing); Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K01951 GMP synthase (glutamine-hydrolysing); Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01951 GMP synthase (glutamine-hydrolysing) |
| EC | 6.3.5.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.9405.1.S1_at
|
| Corresponding NCBI Gene | 842670 |
| Trichome-related Gene from Literature | N/A |