| Detail of EST/Unigene TCMT53216 |
| Acc. | TCMT53216 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 71A1 OS=Persea americana E-value=8e-65; Cytochrome P450 71A2 OS=Solanum melongena E-value=2e-53; Indoleacetaldoxime dehydratase OS=Arabidopsis thaliana E-value=4e-53; Cytochrome P450 71A4 OS=Solanum melongena E-value=4e-53; Cytochrome P450 71A27 OS=Arabidopsis thaliana E-value=5e-53; |
| Length | 1170 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSTEM2 (4 ESTs); MT_DLEAF (2 ESTs); MT_GPOD (1 ESTs); MT_HOGA (1 ESTs); MT_Drought (1 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_IROOT_DSIR (1 ESTs); MT_SEEDROOT_KV3 (1 ESTs); |
| Sequence | ACTGTATTCACTCAATCCATGGGCAACAAGTATTTTTGGAGAAACAATGGCTCTTAAAAA |
| EST members of Unigene | CA920740 AW560989 AW693085 AW692831 AW694400 AW692681 BG646136 BG454515 BG452176 CA917987 BG648729 BF634473 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Biosynthesis of Secondary Metabolites > ko00232 Caffeine metabolism > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07 |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.12672.1.S1_at
|
| Corresponding NCBI Gene | 817628 |
| Trichome-related Gene from Literature | N/A |