| Detail of EST/Unigene TCMT53638 |
| Acc. | TCMT53638 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 71A8 OS=Mentha piperita E-value=3e-92; Cytochrome P450 71A2 OS=Solanum melongena E-value=4e-88; Cytochrome P450 71A4 OS=Solanum melongena E-value=9e-88; Cytochrome P450 71A25 OS=Arabidopsis thaliana E-value=1e-86; Cytochrome P450 71A1 OS=Persea americana E-value=3e-84; |
| Length | 939 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SIRRA (2 ESTs); MTPOSE (1 ESTs); MT_Drought (1 ESTs); MT_JCVI-MT3 (1 ESTs); MT_ECELL (1 ESTs); |
| Sequence | ATGTTGGAGTTTGGAGAGTTGTTGGGTTCATTCTTTATAGGAGATTATATACCTTGGCTT |
| EST members of Unigene | BF643740 AJ498421 BQ157052 BQ154954 BF633591 EY475762 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1 |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.9381.1.S1_at
|
| Corresponding NCBI Gene | 823986 |
| Trichome-related Gene from Literature | N/A |