Detail of EST/Unigene TCMT55834 |
Acc. | TCMT55834 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable glutathione S-transferase OS=Glycine max E-value=4e-79; Glutathione S-transferase U7 OS=Arabidopsis thaliana E-value=2e-50; Glutathione S-transferase U8 OS=Arabidopsis thaliana E-value=3e-49; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=2e-47; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=2e-46; |
Length | 789 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS (2 ESTs); MT_JCVI-MT3 (2 ESTs); MTUS_MIXTISSUE (1 ESTs); MTAMP (1 ESTs); |
Sequence | GAATGAGTAACTGGAGCACTACGATGGCATCAAACAAGGAAGAGGTGAAGCTTTTTGGAA |
EST members of Unigene | CA922710 AL388614 AL388613 AJ501832 EY476335 EY474522 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00310 pyrimidodiazepine synthase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 1.5.4.1 1.8.5.1 2.5.1.18 2.8.-.- |
Transcription Factor Family | |
Transporter Classification Family | 1.A.1 Voltage-gated ion channel superfamily VIC; 1.A.12 Organellar chloride channel O-ClC |
Probeset |
Mtr.11080.1.S1_s_at, Mtr.41149.1.S1_at
|
Corresponding NCBI Gene | 817491 |
Trichome-related Gene from Literature | N/A |