| Detail of EST/Unigene TCMT55835 |
| Acc. | TCMT55835 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable glutathione S-transferase OS=Glycine max E-value=1e-84; Glutathione S-transferase U8 OS=Arabidopsis thaliana E-value=4e-56; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=9e-53; Glutathione S-transferase U7 OS=Arabidopsis thaliana E-value=1e-52; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=2e-52; |
| Length | 928 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JAS_ROOR (11 ESTs); MT_JCVI-MT2 (7 ESTs); MT_ECELL (4 ESTs); MT_NOD_ROOT (3 ESTs); MT_HOGA (1 ESTs); MT_JCVI-MT1 (1 ESTs); MTAMP (1 ESTs); |
| Sequence | GGATCAATCAAACAAGCAAAAACAGTTGTTAGAGCAAATAGTTGAAGCACTAAGATGGCA |
| EST members of Unigene | BG448163 BF647238 BF644618 BF644088 EV257298 AW685702 AW685127 AW684915 AJ501366 CX535196 CX534631 CX534257 CX533999 CX533016 CX532381 CX531925 CX530156 CX530103 CX530069 CX529910 BG649105 GE350342 GE349130 GE349844 GE344806 GE345381 GE345373 GE344003 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
| EC | 2.5.1.18 |
| Transcription Factor Family | |
| Transporter Classification Family | 1.A.1 Voltage-gated ion channel superfamily VIC; 1.A.12 Organellar chloride channel O-ClC |
| Probeset |
Mtr.40278.1.S1_at
|
| Corresponding NCBI Gene | 820083 |
| Trichome-related Gene from Literature | N/A |