| Detail of EST/Unigene TCMT56161 |
| Acc. | TCMT56161 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Soyasaponin III rhamnosyltransferase OS=Glycine max E-value=0; Putative UDP-rhamnose:rhamnosyltransferase 1 OS=Fragaria ananassa E-value=0; UDP-glycosyltransferase 91A1 OS=Arabidopsis thaliana E-value=5e-95; UDP-glycosyltransferase 91B1 OS=Arabidopsis thaliana E-value=7e-87; UDP-glycosyltransferase 91C1 OS=Arabidopsis thaliana E-value=1e-85; |
| Length | 1712 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT (5 ESTs); GLSD (3 ESTs); MTUS_MIXTISSUE (2 ESTs); MT_Drought (1 ESTs); MT_Shoots (1 ESTs); MT_DSIL (1 ESTs); MT_SROOT_KV2 (1 ESTs); MTFLOW (1 ESTs); MtBA (1 ESTs); |
| Sequence | CTCCATCCATCCATCCATCCTTAACTCTATCTTTAAACTTTTCCTATCCTCTATGGGTTC |
| EST members of Unigene | CF068235 CA918873 CX526946 BF519968 AW256867 BQ122222 BQ122208 BQ122136 AJ497848 AL372170 BG451761 BI267076 BI265402 BI265149 BE322107 BF642503 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00699 glucuronosyltransferase; Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K00699 glucuronosyltransferase |
| EC | 2.4.1.17 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.40639.1.S1_at
|
| Corresponding NCBI Gene | 816790 |
| Trichome-related Gene from Literature | N/A |