| Detail of EST/Unigene TCMT56730 |
| Acc. | TCMT56730 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glyoxylate reductase OS=Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3) E-value=2e-48; Glyoxylate reductase OS=Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1) E-value=5e-47; Glyoxylate reductase OS=Thermococcus onnurineus (strain NA1) E-value=2e-45; Glyoxylate reductase OS=Thermococcus litoralis E-value=3e-45; Glyoxylate reductase OS=Pyrococcus kodakaraensis (strain ATCC BAA-918 / JCM 12380 / KOD1) E-value=4e-45; |
| Length | 1222 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SROOT_KV2 (5 ESTs); MTAMP (1 ESTs); MT_DFLOWER (1 ESTs); MT_JCVI-MT3 (1 ESTs); |
| Sequence | GGGTTACTATATGAATCAGCATCGTCTTCGTGTGCTTATTCCACCAGTTAACGCACCAAA |
| EST members of Unigene | AJ502947 BQ149010 BM780064 BM779936 BM779934 BM779820 BM779702 EY478616 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00630 Glyoxylate and dicarboxylate metabolism > K00015 glyoxylate reductase; Metabolism > Carbohydrate Metabolism > ko00630 Glyoxylate and dicarboxylate metabolism > K00049 glyoxylate reductase (NADP+); Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00049 glyoxylate reductase (NADP+) |
| EC | 1.1.1.26 1.1.1.79 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.44036.1.S1_at
|
| Corresponding NCBI Gene | 844326 |
| Trichome-related Gene from Literature | N/A |