| Detail of EST/Unigene TCMT56800 |
| Acc. | TCMT56800 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase F11 OS=Arabidopsis thaliana E-value=1e-66; Glutathione S-transferase F12 OS=Arabidopsis thaliana E-value=1e-64; Glutathione S-transferase F10 OS=Arabidopsis thaliana E-value=4e-55; Glutathione S-transferase F9 OS=Arabidopsis thaliana E-value=5e-53; Glutathione S-transferase F13 OS=Arabidopsis thaliana E-value=3e-43; |
| Length | 820 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Drought (2 ESTs); MT_JCVI-MT2 (2 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_SIRRA (1 ESTs); MT_VILEAF (1 ESTs); |
| Sequence | CAACATTATAATTATCATCACTGAGATTTTAGGGTATTTTCAAGTAATTAAAGAGCAGGG |
| EST members of Unigene | CA922995 BQ154305 CX520929 BF634976 BF633012 GE351422 GE346943 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
| EC | 2.5.1.18 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.47151.1.S1_at
|
| Corresponding NCBI Gene | 821227 |
| Trichome-related Gene from Literature | N/A |