Detail of EST/Unigene TCMT59406 |
Acc. | TCMT59406 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Ribosomal protein S2, mitochondrial OS=Arabidopsis thaliana E-value=3e-64; UTP--glucose-1-phosphate uridylyltransferase OS=Musa acuminata E-value=3e-51; UTP--glucose-1-phosphate uridylyltransferase OS=Solanum tuberosum E-value=7e-49; UTP--glucose-1-phosphate uridylyltransferase OS=Pyrus pyrifolia E-value=5e-48; UTP--glucose-1-phosphate uridylyltransferase OS=Hordeum vulgare E-value=5e-48; |
Length | 1617 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBA (2 ESTs); MT_IROOT_DSIR (2 ESTs); MT_INSECT (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_NOD_ROOT (1 ESTs); MT_SEEDROOT_KV3 (1 ESTs); MT_DFLOWER (1 ESTs); MT_SROOT_KV2 (1 ESTs); MT_SROOT_KV0 (1 ESTs); |
Sequence | ATGTTCCTGTATAATAAATTTTGTTTTACAGTTGATTGAGAAGGGAGGGAGAGAGAGAGA |
EST members of Unigene | AW559883 AW559882 EV258843 AW686167 CB891991 BQ147587 AW256346 BE204505 AL369365 AL366722 BE322559 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K00963 UTP--glucose-1-phosphate uridylyltransferase; Metabolism > Carbohydrate Metabolism > ko00520 Nucleotide sugars metabolism > K00963 UTP--glucose-1-phosphate uridylyltransferase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00963 UTP--glucose-1-phosphate uridylyltransferase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00963 UTP--glucose-1-phosphate uridylyltransferase |
EC | 2.7.7.9 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.43668.1.S1_at
|
Corresponding NCBI Gene | 821211 |
Trichome-related Gene from Literature | N/A |