Detail of EST/Unigene TCMT59700 |
Acc. | TCMT59700 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Ribosome biogenesis protein NSA2 homolog OS=Dictyostelium discoideum E-value=2e-67; Ribosome biogenesis protein NSA2 homolog OS=Homo sapiens E-value=2e-63; Ribosome biogenesis protein NSA2 homolog OS=Mus musculus E-value=3e-63; Ribosome biogenesis protein NSA2 homolog OS=Bos taurus E-value=3e-63; Ribosome biogenesis protein NSA2 homolog OS=Rattus norvegicus E-value=6e-62; |
Length | 758 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1 (2 ESTs); MT_INSECT (2 ESTs); MT_JCVI-MT3 (1 ESTs); MT_CDS (1 ESTs); MT_DSTEM2 (1 ESTs); MT_ECELL (1 ESTs); MtRHE (1 ESTs); |
Sequence | CTAACTCCTAAGCCGCCTCCCATACTTGAATCCCCCCAACGAGAGTAGCTTCTCGACAAA |
EST members of Unigene | BT050628 BE325733 BF650820 EV257805 EV257712 AA660868 BG449919 BF642178 EY476277 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00562 Inositol phosphate metabolism > K00914 phosphatidylinositol 3-kinase; Genetic Information Processing > Folding, Sorting and Degradation > ko04140 Regulation of autophagy > K00914 phosphatidylinositol 3-kinase; Environmental Information Processing > Signal Transduction > ko04070 Phosphatidylinositol signaling system > K00914 phosphatidylinositol 3-kinase |
EC | 2.7.1.137 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.13267.1.S1_at
|
Corresponding NCBI Gene | 830524 |
Trichome-related Gene from Literature | N/A |