Detail of EST/Unigene TCMT59720 |
Acc. | TCMT59720 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,3-galactosyltransferase 14 OS=Arabidopsis thaliana E-value=0; Probable beta-1,3-galactosyltransferase 13 OS=Arabidopsis thaliana E-value=0; Probable beta-1,3-galactosyltransferase 12 OS=Arabidopsis thaliana E-value=0; Probable beta-1,3-galactosyltransferase 5 OS=Arabidopsis thaliana E-value=1e-38; Probable beta-1,3-galactosyltransferase 8 OS=Arabidopsis thaliana E-value=6e-38; |
Length | 1381 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_CDS (1 ESTs); MtBB_NOD (1 ESTs); MT_DSTEM2 (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_HOGA (1 ESTs); MtBA (1 ESTs); |
Sequence | GGTGGACACGGCAAAGAAAGAGGCACGCCAAAAGCTAGATTAGTCTTGTTAATGTCCATC |
EST members of Unigene | BT051715 AL376362 AW692716 EV255706 BG648444 AL370187 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Glycan Biosynthesis and Metabolism > ko00532 Chondroitin sulfate biosynthesis > K00734 galactosylxylosylprotein 3-beta-galactosyltransferase; Metabolism > Glycan Biosynthesis and Metabolism > ko01030 Glycan structures - Biosynthesis 1 > K00734 galactosylxylosylprotein 3-beta-galactosyltransferase; Metabolism > Glycan Biosynthesis and Metabolism > ko01031 Glycan structures - Biosynthesis 2 > K07819 beta-1,3-galactosyltransferase 1; Metabolism > Glycan Biosynthesis and Metabolism > ko00601 Glycosphingolipid biosynthesis - lacto and neolacto series > K07819 beta-1,3-galactosyltransferase 1 |
EC | 2.4.1.- 2.4.1.134 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.42157.1.S1_at, Mtr.9452.1.S1_at
|
Corresponding NCBI Gene | 841763 |
Trichome-related Gene from Literature | N/A |