Detail of EST/Unigene TCMT60594 |
Acc. | TCMT60594 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Carbamoyl-phosphate synthase large chain OS=Nostoc sp. (strain PCC 7120 / UTEX 2576) E-value=0; Carbamoyl-phosphate synthase large chain OS=Synechocystis sp. (strain PCC 6803 / Kazusa) E-value=0; Carbamoyl-phosphate synthase large chain OS=Xanthomonas axonopodis pv. citri (strain 306) E-value=0; Carbamoyl-phosphate synthase large chain OS=Xanthomonas campestris pv. campestris (strain ATCC 33913 / NCPPB 528 / LMG 568) E-value=0; Carbamoyl-phosphate synthase large chain OS=Archaeoglobus fulgidus (strain ATCC 49558 / VC-16 / DSM 4304 / JCM 9628 / NBRC 100126) E-value=0; |
Length | 1249 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1 (1 ESTs); MT_SEEDROOT_KV3 (1 ESTs); MT_GPOD (1 ESTs); MT_GSEED (1 ESTs); |
Sequence | AAATCCCGAGACTGTATCCACAGATTACGACACTAGTGATCGTCTCTACTTTGAACCCTT |
EST members of Unigene | CX542296 EV258053 BG646149 BI309070 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K01948 carbamoyl-phosphate synthase (ammonia); Metabolism > Amino Acid Metabolism > ko00330 Arginine and proline metabolism > K01948 carbamoyl-phosphate synthase (ammonia); Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01948 carbamoyl-phosphate synthase (ammonia); Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K01948 carbamoyl-phosphate synthase (ammonia) |
EC | 6.3.4.16 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.41922.1.S1_at, Mtr.7128.1.S1_at
|
Corresponding NCBI Gene | 839868 |
Trichome-related Gene from Literature | N/A |