| Detail of EST/Unigene TCSL72338 |
| Acc. | TCSL72338 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=0; |
| Length | 1011 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015436 (1 ESTs); |
| Sequence | GGCCATTACGGCCGGGGATCTCTTCTTTTTTTGTACATTCTAAGAGTTCATAATGGCTGC |
| EST members of Unigene | BP900154 SRR015436.119310 BP899193 BP878722 AW039567 AI782251 BG125623 BP896300 DB693026 BP898233 BP910200 BP898993 SRR015436.182044 AI490684 AI483255 AI772496 SRR015435.213833 BI930671 BP903241 BP897252 SRR015436.252971 BP898213 BP897461 BP897654 BP905778 AI775814 AW092769 BP906360 AI778573 CK715003 AI774467 BG627574 BP900960 BP896696 BP898048 BP898620 AW623214 BP897656 BP897463 AW092954 BG124664 BP904225 BP896305 BP896888 BG630474 BW689894 BG126119 SRR015436.198360 BG643041 AW443131 BG127119 SRR015435.248606 SRR015436.165419 BG128863 BG128286 AI777261 AI774587 SRR015435.307912 AW039493 BG625935 SRR015435.160370 DB700328 AW041259 SRR015435.241834 BP880405 BP897211 BP884268 AI780464 BG643251 SRR015436.2380 DB695824 BP875798 AI490677 AW096775 BG631394 AW094702 AI490679 BP898789 BP901303 BG644033 BG627526 BP897814 AI777270 BG630034 BG626173 BP897042 BP888735 BG626753 AW037575 BG626174 AW038964 BG123565 SRR015435.349066 DB680396 BP898698 BP897540 AW041015 BP911258 BP908939 SRR015436.45654 DB704505 BP905072 SRR015436.157347 BP905636 BP884198 AW039836 BP904484 BG626660 BP903906 DB687343 AW093625 BP900048 SRR015436.142645 AI490794 BI929097 BP903933 BP908763 SRR015436.132577 BG626496 BP900457 AW094230 BG127562 BG123797 BG128626 BP910308 BP900067 DB701694 SRR015436.110739 BG642800 BP890212 BI929873 BG124465 BP897362 AI776287 SRR015435.164671 BP903360 AI779012 BG129510 BG642936 BG628942 BG128943 BP903100 AI776619 SRR015436.277781 DB690165 BP889190 SRR015436.207576 BG629906 BP897297 BP905790 BG128354 BP905405 AW093961 DB691712 AI776414 AW094350 BG735442 SRR015436.139631 BP903875 BG127684 BG130303 SRR015436.287706 BG626647 AI777166 BG630704 AW092619 BP899259 SRR015435.42221 BG626845 BP905442 SRR015435.293646 SRR015436.299751 BP877037 AI781521 AW096457 AW442451 BG626057 BP909291 AI776434 BG125095 BP897315 BP907362 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |