Detail of EST/Unigene TCSL74210 |
Acc. | TCSL74210 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Gamma-glutamyltranspeptidase 1 OS=Mus musculus E-value=9e-99; Gamma-glutamyltranspeptidase 1 OS=Rattus norvegicus E-value=4e-98; Gamma-glutamyltranspeptidase 1 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=6e-97; Gamma-glutamyltranspeptidase 1 OS=Homo sapiens E-value=2e-95; Gamma-glutamyltranspeptidase 1 OS=Sus scrofa E-value=7e-93; |
Length | 1786 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015436 (17 ESTs); SRR015435 (13 ESTs); LIBEST_024426 (12 ESTs); SL_MicroLEAF3 (9 ESTs); SL_MicroFRUIT (3 ESTs); SL_maturing_fruit (3 ESTs); SL_CELL_BTI (2 ESTs); SL_SHOOT_4WEEK (2 ESTs); SL_RIP_FRUIT_TAMU (1 ESTs); SL_breaker_fruit (1 ESTs); SL_TAMU_CALLUS (1 ESTs); SL_RES (1 ESTs); SL_DEF_ROOT (1 ESTs); |
Sequence | GTGGAGAAACATAATTTGGAAGCTCCACTTTTGGACTCTACTTCTCCTCTTTGTTCTAAT |
EST members of Unigene | DB705920 SRR015435.13168 AW223512 SRR015436.267758 DB680003 SRR015435.34549 DB682705 DB727379 BP875611 FS198856 SRR015436.285466 SRR015436.53062 SRR015436.90388 FS179546 BP888984 SRR015435.30470 BM410868 FS182835 SRR015436.107927 SRR015435.220319 SRR015435.287774 SRR015435.184144 SRR015435.270338 FS196031 BP887537 SRR015436.274231 AI894620 SRR015436.198374 DB701833 SRR015435.293956 FS206259 DB689816 FS188595 DB685224 DB714665 SRR015436.278392 BG126667 SRR015436.50760 FS203191 SRR015435.5262 SRR015436.188830 BF097162 FS200181 SRR015435.60243 DB727527 DB700832 SRR015436.282398 FS199272 AW442478 SRR015435.196059 SRR015436.284334 SRR015436.230394 DB683941 AW442441 BG127401 SRR015436.47716 AI776042 FS195875 DB706004 FS196484 SRR015436.193965 SRR015436.188639 SRR015435.76358 FS202390 SRR015435.296159 SRR015436.99651 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00430 Taurine and hypotaurine metabolism > K00681 gamma-glutamyltranspeptidase |
EC | 2.3.2.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829042 |
Trichome-related Gene from Literature | 829042 |