| Detail of EST/Unigene TCSL79007 |
| Acc. | TCSL79007 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Ribosomal protein S14, mitochondrial OS=Oenothera berteriana E-value=4e-37; Ribosomal protein S14, mitochondrial OS=Vicia faba E-value=5e-35; Ribosomal protein S14, mitochondrial OS=Brassica napus E-value=1e-34; Ribosomal protein S14, mitochondrial OS=Marchantia polymorpha E-value=8e-28; 30S ribosomal protein S14 OS=Maricaulis maris (strain MCS10) E-value=5e-20; |
| Length | 803 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435 (16 ESTs); SRR015436 (5 ESTs); SL_TAMU (4 ESTs); LIBEST_025267 (1 ESTs); SL_MicroLEAF3 (1 ESTs); SL_MicroFRUIT (1 ESTs); SL_SUS_LEAF (1 ESTs); |
| Sequence | GGCCATTACGGCCGGGGATAGTGTTAATGTAATTTAAGAATTCGAAATAATATTTTTCTC |
| EST members of Unigene | AI488632 SRR015435.174490 AI489600 AI898851 SRR015436.128959 SRR015435.169467 AI899394 SRR015435.24853 SRR015435.127439 SRR015435.83467 SRR015436.321026 SRR015435.258336 SRR015435.131136 SRR015435.200022 SRR015435.203905 SRR015435.301063 SRR015435.209055 DB705096 DB709136 SRR015436.126120 GT167968 SRR015435.335114 SRR015435.341903 SRR015435.94017 SRR015435.42259 SRR015436.89748 SRR015436.72026 SRR015435.203104 AI782072 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818015 |
| Trichome-related Gene from Literature | 818015 |