Detail of EST/Unigene TCMT40949 |
Acc. | TCMT40949 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Ribulose bisphosphate carboxylase small chain 3A, chloroplastic OS=Pisum sativum E-value=8e-85; Ribulose bisphosphate carboxylase small chain 3C, chloroplastic OS=Pisum sativum E-value=9e-84; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Medicago sativa E-value=4e-81; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Trifolium repens E-value=3e-75; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Glycine tomentella E-value=3e-73; |
Length | 774 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSLC (12 ESTs); MT_VILEAF (11 ESTs); MT_UV-B (9 ESTs); MT_DLEAF (8 ESTs); MT_DSIL (7 ESTs); MT_Drought (6 ESTs); MT_PhoLEAF (5 ESTs); MT_INSECT (4 ESTs); MT_DFLOWER (1 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_Shoots (1 ESTs); |
Sequence | GTATATCTTACTAGTGAACTAAGGGAGAAAAACATGGCTTCCTCTATGATGTCCTCTTCA |
EST members of Unigene | CF067954 CX524744 BF006658 BF006540 BF006242 BF006090 BF005845 BF005695 BF005646 BF005582 BF005489 BF005363 BF005191 AW127701 DY633362 DY632934 DY632859 DY632858 DY632802 DY632788 DY632765 DY632652 DY632490 BQ147865 BE317644 AW683418 BE316762 BE316039 BE319121 BE317969 BE317669 BE318958 BF520349 BF519950 BF519070 AW981192 AW776925 AW776796 AW775873 BI263960 BI263849 BG458084 BG457975 BF638836 CX522607 CX522155 CX521239 CX520949 CX520817 CX520794 CX519463 CX519432 CX517378 CX516934 CX516565 BG450049 BF634633 BF633914 BF633428 BF633423 BF632164 BI266276 BI266169 BG449895 BF641702 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1661.1.S1_s_at
|
Corresponding NCBI Gene | 843029 |
Trichome-related Gene from Literature | 843029 |