| Detail of EST/Unigene TCMT41989 |
| Acc. | TCMT41989 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Mitochondrial import receptor subunit TOM5 homolog OS=Arabidopsis thaliana E-value=7e-11; |
| Length | 603 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GSEED (9 ESTs); MtBB_NOD (5 ESTs); MT_SIRRA (3 ESTs); MT_JCVI-MT3 (1 ESTs); MT_JCVI-MT2 (1 ESTs); MT_TRI (1 ESTs); MT_NOD_NOLLY (1 ESTs); MT_Drought (1 ESTs); |
| Sequence | TGATTACGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGC |
| EST members of Unigene | DY618360 AL377825 AL377824 AL375156 AL374431 AL374430 CX541179 CX541069 CX538873 CX538652 CX536445 CX536390 CX536335 BQ145200 BI268408 BQ156914 BQ154367 BQ152129 BF636457 EY477554 GE345921 EX533280 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.40043.1.S1_s_at
|
| Corresponding NCBI Gene | 830698 |
| Trichome-related Gene from Literature | N/A |