Detail of EST/Unigene TCMT43303 |
Acc. | TCMT43303 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Anthocyanidin 5,3-O-glucosyltransferase OS=Rosa hybrid cultivar E-value=0; UDP-glycosyltransferase 88A1 OS=Arabidopsis thaliana E-value=0; Baicalein 7-O-glucuronosyltransferase OS=Scutellaria baicalensis E-value=2e-88; Hydroquinone glucosyltransferase OS=Rauvolfia serpentina E-value=3e-70; UDP-glycosyltransferase 72B2 OS=Arabidopsis thaliana E-value=2e-66; |
Length | 1926 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS (5 ESTs); MT_JAS_ROOR (4 ESTs); MtBB_NOD (3 ESTs); MT_MGHG (2 ESTs); MT_ECELL (2 ESTs); MT_ROOTPHOS (2 ESTs); MT_SEEDROOT_KV3 (2 ESTs); MtBA (2 ESTs); MT_Drought (1 ESTs); MT_DSTEM2 (1 ESTs); MHRP-root (1 ESTs); MT_SROOT_KV0 (1 ESTs); MT_CDS (1 ESTs); MTUS_MIXTISSUE (1 ESTs); |
Sequence | CTAGCTTTGTACTCTAACCTTCTCTTCATTTCCAATTTCTCATAATCATCAAAATGAAGG |
EST members of Unigene | DQ875461 CA922183 AL387986 AL387985 AL385839 AL382057 AL382056 AL377552 AL377551 AL375825 AW697125 BF647364 BF644156 AW329843 AW287979 BE239803 CB891743 BG645510 BE204057 CX534595 CX532449 CX532218 CX530738 AL366972 AL366971 BE942403 BE942133 BF633767 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00699 glucuronosyltransferase; Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K00699 glucuronosyltransferase |
EC | 2.4.1.17 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.40636.1.S1_at, Mtr.8866.1.S1_at
|
Corresponding NCBI Gene | 820900 |
Trichome-related Gene from Literature | N/A |