Detail of EST/Unigene TCMT43316 |
Acc. | TCMT43316 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Cysteine proteinase inhibitor 5 OS=Arabidopsis thaliana E-value=2e-25; Cysteine proteinase inhibitor 1 OS=Actinidia deliciosa E-value=2e-23; Cysteine proteinase inhibitor 4 OS=Arabidopsis thaliana E-value=2e-19; Cysteine proteinase inhibitor 8 OS=Oryza sativa subsp. japonica E-value=8e-17; Cysteine proteinase inhibitor 1 OS=Oryza sativa subsp. japonica E-value=3e-16; |
Length | 677 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR (7 ESTs); MT_SIRRA (6 ESTs); MT_JCVI-MT2 (5 ESTs); MTFLOW (4 ESTs); MT_MGHG (3 ESTs); MT_JCVI-MT3 (2 ESTs); MT_DROOT (2 ESTs); MT_JCVI-MT1 (1 ESTs); MT_NOD_ROOT (1 ESTs); MT_ROOTPHOS (1 ESTs); MHRP-root (1 ESTs); |
Sequence | GGGCAAATCCGTAAAACCCGACACGTACCTATCAAATCTAAGAAGCCCCATAACTCACGC |
EST members of Unigene | BE320602 BE319829 EV254838 BG448618 AW287902 BE240736 BQ156674 BQ155832 BQ154929 BQ154478 BI269513 BI269062 CX535250 CX535200 CX534491 CX532633 CX531949 CX530464 CX530204 AJ497754 AJ497524 AJ497338 AJ497249 BE943182 BE942697 BE942182 EY478595 EY476021 GE351033 GE348451 GE349289 GE346213 GE346212 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.20373.1.S1_at
|
Corresponding NCBI Gene | 834805 |
Trichome-related Gene from Literature | N/A |