Detail of EST/Unigene TCMT43791 |
Acc. | TCMT43791 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | N-carbamoylputrescine amidase OS=Solanum tuberosum E-value=0; N-carbamoylputrescine amidase OS=Solanum lycopersicum E-value=0; N-carbamoylputrescine amidase OS=Arabidopsis thaliana E-value=0; N-carbamoylputrescine amidase OS=Oryza sativa subsp. japonica E-value=0; Probable nitrilase C965.09 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=2e-30; |
Length | 1363 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBA (2 ESTs); MtBB_NOD (2 ESTs); MT_JCVI-MT1 (2 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_GESD (1 ESTs); MT_DFLOWER (1 ESTs); MT_DLEAF (1 ESTs); MT_JAS_ROOR (1 ESTs); MT_JCVI-MT3 (1 ESTs); MT_Shoots (1 ESTs); |
Sequence | GAAAGAAAGATGTTGTACGCAACACGCACACCCAGAGCATAAAGTGTTTTTTCAGAAAGT |
EST members of Unigene | AL377674 AL377673 CX524888 EV260649 EV256605 DW015416 CA990621 BQ147137 BG454974 CX529673 AL368253 AL368252 EY474815 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K01431 beta-ureidopropionase; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K01431 beta-ureidopropionase; Metabolism > Metabolism of Other Amino Acids > ko00410 beta-Alanine metabolism > K01431 beta-ureidopropionase; Metabolism > Metabolism of Cofactors and Vitamins > ko00770 Pantothenate and CoA biosynthesis > K01431 beta-ureidopropionase |
EC | 3.5.1.6 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.41002.1.S1_at
|
Corresponding NCBI Gene | 817290 |
Trichome-related Gene from Literature | N/A |