| Detail of EST/Unigene TCMT46848 |
| Acc. | TCMT46848 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable glutathione S-transferase OS=Nicotiana tabacum E-value=2e-47; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=4e-47; Glutathione S-transferase U8 OS=Arabidopsis thaliana E-value=2e-46; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=2e-45; Probable glutathione S-transferase OS=Glycine max E-value=6e-44; |
| Length | 845 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBA (4 ESTs); MTAMP (3 ESTs); MtBC_GLOMUS (2 ESTs); MT_SIRRA (2 ESTs); MT_Drought (2 ESTs); MTAPHEU (1 ESTs); MtSNF (1 ESTs); |
| Sequence | GGATAAGACAAATTAATTAAGATGGCAGATCAAGTGAAGATACATGGATTTTGGTACAGT |
| EST members of Unigene | AL383296 AL383295 AJ548194 AJ503482 AJ503394 AJ502360 AJ845285 BQ156177 BQ155531 AL373084 AL373083 AL367561 AL367560 BF633059 BF632057 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
| EC | 2.5.1.18 |
| Transcription Factor Family | |
| Transporter Classification Family | 1.A.1 Voltage-gated ion channel superfamily VIC; 1.A.12 Organellar chloride channel O-ClC |
| Probeset |
Mtr.18369.1.S1_at
|
| Corresponding NCBI Gene | 820083 |
| Trichome-related Gene from Literature | N/A |