Detail of EST/Unigene TCMT46858 |
Acc. | TCMT46858 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | unknown |
Length | 697 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS (3 ESTs); MT_PhoLEAF (2 ESTs); MTFLOW (2 ESTs); MT_JCVI-MT2 (2 ESTs); MT_NOD_GVN (1 ESTs); MT_GESD (1 ESTs); MT_DFLOWER (1 ESTs); MT_JCVI-MT3 (1 ESTs); MT_GSEED (1 ESTs); MT_NOD_GVSN (1 ESTs); |
Sequence | CAGCACAAACAAACACACTGATTCTTCTTCTTCTTCTAGCAGAATCGATCCACAGAGAAA |
EST members of Unigene | AL386289 AL386288 AL385696 CX538163 BE998369 AW573976 CA990712 BQ149602 BF638899 BF637520 AJ497162 AJ497161 EY475163 GE350390 GE345435 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 3.D.1 Proton-translocating NADH dehydrogenase NDH |
Probeset |
Mtr.38037.1.S1_at
|
Corresponding NCBI Gene | 827343 |
Trichome-related Gene from Literature | N/A |