| Detail of EST/Unigene TCMT47139 |
| Acc. | TCMT47139 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Aldo-keto reductase family 4 member C9 OS=Arabidopsis thaliana E-value=0; Aldo-keto reductase family 4 member C10 OS=Arabidopsis thaliana E-value=0; Aldo-keto reductase family 4 member C11 OS=Arabidopsis thaliana E-value=0; Aldo-keto reductase family 4 member C8 OS=Arabidopsis thaliana E-value=0; Aldose reductase OS=Hordeum vulgare E-value=2e-68; |
| Length | 1200 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT1 (3 ESTs); MtBC_GLOMUS (2 ESTs); MT_JCVI-MT2 (1 ESTs); MT_TRI (1 ESTs); MT_CDS (1 ESTs); MT_DSTEM2 (1 ESTs); MT_JCVI-MT3 (1 ESTs); |
| Sequence | GATTCTCATTCTCATTTTCGCCCCCATTGAAGCCGACAAACCATTTTTCTCTTTTTCACC |
| EST members of Unigene | BT051694 AL385532 AL385531 BE325177 EV256827 EV255821 EV255535 EY476998 GE344309 EX531948 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00930 Caprolactam degradation > K00002 alcohol dehydrogenase (NADP+); Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00002 alcohol dehydrogenase (NADP+); Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K00002 alcohol dehydrogenase (NADP+); Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00011 aldehyde reductase; Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K00011 aldehyde reductase |
| EC | 1.1.1.2 1.1.1.21 |
| Transcription Factor Family | |
| Transporter Classification Family | 8.A.5 Voltage-gated K+ channel b-subunit VICb |
| Probeset |
Mtr.31917.1.S1_at, Mtr.45308.1.S1_at
|
| Corresponding NCBI Gene | 818354 |
| Trichome-related Gene from Literature | N/A |