| Detail of EST/Unigene TCMT47641 |
| Acc. | TCMT47641 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutamate--tRNA ligase, chloroplastic/mitochondrial OS=Arabidopsis thaliana E-value=0; Glutamate--tRNA ligase, chloroplastic/mitochondrial OS=Nicotiana tabacum E-value=0; Glutamate--tRNA ligase, chloroplastic/mitochondrial OS=Hordeum vulgare E-value=0; Glutamate--tRNA ligase OS=Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF) E-value=1e-46; Glutamate--tRNA ligase OS=Carboxydothermus hydrogenoformans (strain Z-2901 / DSM 6008) E-value=1e-46; |
| Length | 1179 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBA (2 ESTs); MT_DSIL (1 ESTs); MT_VILEAF (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_NOD_GVN (1 ESTs); |
| Sequence | CAATGATGCTACCATGGCTATTTCTCATGTTATTTAGATTTGAGGAGCATTTACCAAACA |
| EST members of Unigene | EV262344 AW573716 AW776952 CX519734 AL365755 AL365754 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01885 glutamyl-tRNA synthetase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K01885 glutamyl-tRNA synthetase; Genetic Information Processing > Translation > ko00970 Aminoacyl-tRNA biosynthesis > K01885 glutamyl-tRNA synthetase |
| EC | 6.1.1.17 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.10787.1.S1_at
|
| Corresponding NCBI Gene | 836526 |
| Trichome-related Gene from Literature | N/A |