| Detail of EST/Unigene TCMT47822 |
| Acc. | TCMT47822 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Protein IQ-DOMAIN 31 OS=Arabidopsis thaliana E-value=6e-15; DNA ligase 1 OS=Dictyostelium discoideum E-value=4e-12; Nucleolar protein 58 OS=Dictyostelium discoideum E-value=1e-09; Transcriptional regulator ATRX homolog OS=Caenorhabditis elegans E-value=2e-09; Dynein heavy chain-like protein PF11_0240 OS=Plasmodium falciparum (isolate 3D7) E-value=3e-09; |
| Length | 1439 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GSEED (2 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_IROOT_DSIR (1 ESTs); MT_PhoLEAF (1 ESTs); |
| Sequence | TTCAGATCAAACTGTTACTGATGTTTCAGAGCAGGGGTCAGGTTCCTCTTCTGAGAAAAT |
| EST members of Unigene | CA923134 CX539320 CX538429 AW561038 BI264573 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03410 Base excision repair > K10747 DNA ligase 1; Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K10747 DNA ligase 1; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K10747 DNA ligase 1; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K10747 DNA ligase 1 |
| EC | 6.5.1.1 |
| Transcription Factor Family | NF-YB |
| Transporter Classification Family | |
| Probeset |
Mtr.13264.1.S1_at, Mtr.25706.1.S1_s_at
|
| Corresponding NCBI Gene | 814808 |
| Trichome-related Gene from Literature | N/A |