Detail of EST/Unigene TCMT52956 |
Acc. | TCMT52956 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Formimidoyltransferase-cyclodeaminase OS=Mus musculus E-value=1e-14; Formimidoyltransferase-cyclodeaminase OS=Rattus norvegicus E-value=2e-14; Formimidoyltransferase-cyclodeaminase OS=Sus scrofa E-value=2e-14; Formimidoyltransferase-cyclodeaminase OS=Dictyostelium discoideum E-value=1e-13; Formimidoyltransferase-cyclodeaminase OS=Homo sapiens E-value=7e-12; |
Length | 1365 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBB_NOD (4 ESTs); MT_JCVI-MT1 (3 ESTs); MT_JCVI-MT3 (2 ESTs); MT_JCVI-MT2 (2 ESTs); MT_FLOSEED_MTY (1 ESTs); MTAMP (1 ESTs); MT_DFLOWER (1 ESTs); MT_JAS_ROOR (1 ESTs); MT_TRI (1 ESTs); MT_IROOT_DSIR (1 ESTs); MT_DSTEM2 (1 ESTs); MT_ECELL (1 ESTs); |
Sequence | GGTACTGTACCATATAAAAATGTCCACCTTGTACACGAGTTCCCACTTCAAGTTATTAGT |
EST members of Unigene | AL379814 AL379813 AL378567 AL378566 AW560666 AW691323 BF645425 EV260903 EV258102 EV256589 DW016694 AJ501180 BQ148920 CX534177 EY477925 EY474424 GE348632 GE343402 EX528877 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00340 Histidine metabolism > K00603 glutamate formiminotransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00670 One carbon pool by folate > K00603 glutamate formiminotransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00670 One carbon pool by folate > K01746 formiminotetrahydrofolate cyclodeaminase |
EC | 2.1.2.5 4.3.1.4 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.12735.1.S1_at, Mtr.1536.1.S1_s_at
|
Corresponding NCBI Gene | 816615 |
Trichome-related Gene from Literature | N/A |