Detail of EST/Unigene TCMT53248 |
Acc. | TCMT53248 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable glutamate--tRNA ligase, cytoplasmic OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=0; Glutamate--tRNA ligase, cytoplasmic OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=0; Bifunctional glutamate/proline--tRNA ligase OS=Mus musculus E-value=0; Bifunctional glutamate/proline--tRNA ligase OS=Drosophila melanogaster E-value=0; Bifunctional glutamate/proline--tRNA ligase OS=Homo sapiens E-value=0; |
Length | 1782 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS (3 ESTs); MT_JCVI-MT2 (2 ESTs); MT_FLOSEED_MTY (1 ESTs); MHRP-root (1 ESTs); MT_SROOT_KV0 (1 ESTs); MT_MGHG (1 ESTs); MT_GSEED (1 ESTs); MT_Shoots (1 ESTs); MT_DSTEM2 (1 ESTs); |
Sequence | CTGAACCCAGTGGCTATCTTCACATTGGACACTCAAAAGCAGCTCTGTTGAACAAGTATT |
EST members of Unigene | AL387416 AL387415 AL384032 CX541916 CX524841 AW696405 DW018926 BE240436 BE204175 BE943083 GE351317 GE346824 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00330 Arginine and proline metabolism > K01881 prolyl-tRNA synthetase; Genetic Information Processing > Translation > ko00970 Aminoacyl-tRNA biosynthesis > K01881 prolyl-tRNA synthetase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01885 glutamyl-tRNA synthetase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K01885 glutamyl-tRNA synthetase; Genetic Information Processing > Translation > ko00970 Aminoacyl-tRNA biosynthesis > K01885 glutamyl-tRNA synthetase |
EC | 6.1.1.15 6.1.1.17 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.14126.1.S1_s_at, Mtr.44165.1.S1_at
|
Corresponding NCBI Gene | 832718 |
Trichome-related Gene from Literature | N/A |