| Detail of EST/Unigene TCMT53449 |
| Acc. | TCMT53449 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable glutathione S-transferase OS=Nicotiana tabacum E-value=4e-49; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=2e-48; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=2e-47; Glutathione S-transferase U3 OS=Arabidopsis thaliana E-value=4e-44; Glutathione S-transferase U8 OS=Arabidopsis thaliana E-value=5e-43; |
| Length | 966 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_HOGA (2 ESTs); MT_JCVI-MT2 (2 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_ROOTPHOS (1 ESTs); MTAMP (1 ESTs); MT_JAS_ROOR (1 ESTs); MT_JCVI-MT3 (1 ESTs); |
| Sequence | GGAAAACATGCACAGGCTAATTAAGATGGCAGAGATAAAACTACATGGATCTTGGTATAG |
| EST members of Unigene | CA922167 AW126292 AJ501218 CX531454 CB894554 CB894380 EY474369 GE352201 GE347857 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
| EC | 2.5.1.18 |
| Transcription Factor Family | |
| Transporter Classification Family | 1.A.1 Voltage-gated ion channel superfamily VIC; 1.A.12 Organellar chloride channel O-ClC |
| Probeset |
Mtr.37396.1.S1_at
|
| Corresponding NCBI Gene | 817496 |
| Trichome-related Gene from Literature | N/A |