Detail of EST/Unigene TCMT55892 |
Acc. | TCMT55892 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | unknown |
Length | 886 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2 (4 ESTs); MtBB_NOD (3 ESTs); MT_ECELL (3 ESTs); MTAMP (1 ESTs); MT_SEEDROOT_KV3 (1 ESTs); MT_DFLOWER (1 ESTs); MT_DLEAF (1 ESTs); MT_SROOT_KV0 (1 ESTs); MT_CDS (1 ESTs); MT_PhoLEAF (1 ESTs); MT_KVKC (1 ESTs); MT_DSTEM2 (1 ESTs); MT_JCVI-MT3 (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_FLOSEED_MTY (1 ESTs); |
Sequence | GGGAGAGAGAGAGAGAGAGAGAGAGAGAGAAAGGACAAAGAAATCGAAGGAGAAGAAGAA |
EST members of Unigene | BT053522 AL381137 AL381136 AL374325 AW694816 BG448155 BG447916 BF648251 EV262588 DW018443 AJ501327 AW774265 BI272619 BG452307 AI737569 BG455194 BQ255407 EY478123 GE347232 GE349892 GE344346 GE344863 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.37798.1.S1_at
|
Corresponding NCBI Gene | 832608 |
Trichome-related Gene from Literature | N/A |