Detail of EST/Unigene TCMT59852 |
Acc. | TCMT59852 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Caffeoyl-CoA O-methyltransferase OS=Petroselinum crispum E-value=9e-94; Caffeoyl-CoA O-methyltransferase 2 OS=Eucalyptus globulus E-value=1e-93; Caffeoyl-CoA O-methyltransferase 5 OS=Nicotiana tabacum E-value=6e-93; Probable caffeoyl-CoA O-methyltransferase At4g34050 OS=Arabidopsis thaliana E-value=6e-93; Caffeoyl-CoA O-methyltransferase OS=Populus tremuloides E-value=1e-92; |
Length | 996 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2 (2 ESTs); MT_JCVI-MT3 (1 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_DSTEM2 (1 ESTs); MT_NOD_GVN (1 ESTs); MT_DSLC (1 ESTs); |
Sequence | TAGTCCAAGAAAATTAAGATAAGTAAACACACTAGAGAGAGATATGGCTGCCAATAATGA |
EST members of Unigene | CA919819 AW695899 BE124333 BF005553 EY477250 GE350345 GE345386 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00545 catechol O-methyltransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00941 Flavonoid biosynthesis > K00588 caffeoyl-CoA O-methyltransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K00588 caffeoyl-CoA O-methyltransferase |
EC | 2.1.1.104 2.1.1.6 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.40942.1.S1_at
|
Corresponding NCBI Gene | 829551 |
Trichome-related Gene from Literature | N/A |